peptides6608.com › News › Background And Molecular Identity — Quick Reference

Background And Molecular Identity — Quick Reference

By Editorial Desk · published 2026-02-04 · last reviewed 2026-03-07 · News

A practical reference on mass spectrometry: what it is, how it behaves, what the literature reports, and where the honest uncertainties sit.

This page was last updated on 2026-03-07 and is reviewed periodically as new material appears.

Background and Molecular Identity

The fragment includes residues that can form an internal disulfide bond between two cysteine positions. This structural feature can influence how the peptide folds and how stable it is in solution. AOD-9604 differs from full-length hGH in size and receptor interactions; it does not contain the entire growth hormone sequence. Published descriptions sometimes use slightly different residue numbering, so sequence information should be checked against primary sources. The molecule is small compared with intact hGH, which affects analytical detection and purification approaches.

Interest in AOD-9604 arose from attempts to separate metabolic effects from growth effects attributed to hGH. Early work explored whether the fragment could influence lipolysis or fat oxidation without promoting growth. Those questions remain partly unresolved because human data are limited and results have varied across studies. The peptide is not a hormone replacement for hGH and is not equivalent to hGH in clinical use. Its research history includes both laboratory studies and commercial marketing claims that are not the same as regulatory approval.

AOD-9604 is a synthetic peptide whose structure corresponds to a C-terminal segment of human growth hormone. It is often described as hGH fragment 176-191, a 16-amino-acid sequence. The peptide was designed to isolate a region of hGH associated with fat metabolism while avoiding the full hormone's growth-promoting actions. Laboratory and commercial materials typically present it as a lyophilized powder for research use. Its identity is defined by amino acid sequence, not by a single brand.

Identity and Research Context

Early interest in AOD-9604 centered on whether a fragment of human growth hormone could influence fat metabolism without the broader effects of the full hormone. Cell and animal studies reported changes in fat storage and breakdown. Human trials followed, but the results were not strong enough to secure regulatory approval. The compound remains available for laboratory research, and its clinical potential is still described as uncertain. Studies continue to examine its activity and safety profile.

AOD-9604 is a synthetic peptide that corresponds to a short section of human growth hormone. It is commonly identified as hGH fragment 176-191 because its sequence matches residues at the C-terminal end of the hormone. The molecule contains sixteen amino acids and is made by solid-phase peptide synthesis. Researchers study it for metabolic effects rather than for the growth-promoting actions associated with full human growth hormone. Its small size distinguishes it from the complete 191-amino-acid hormone.

Aod-9604 at a glance

PropertyValueNotes
Molecular classSynthetic peptideBased on the C-terminal region of human growth hormone.
Amino acid length16 residuesOften described as hGH fragment 176-191.
AppearanceLyophilized powderTypically white to off-white; exact appearance depends on grade.
SolubilitySoluble in waterAqueous solubility depends on pH, ionic strength, and preparation.
Typical storage-20 °C or lowerLyophilized peptide is usually kept cold and dry; solutions may require freezing.

Handling And Analytical Properties

Identity and purity are commonly checked with reversed-phase high-performance liquid chromatography and mass spectrometry. RP-HPLC separates the peptide from related impurities and can estimate purity by peak area. Mass spectrometry confirms molecular mass and helps detect sequence variants or truncations. Some laboratories use amino acid analysis or peptide mapping for additional characterization. No single method proves biological activity; these techniques establish chemical identity and purity only. They also require suitable reference standards for confident comparison.

Commercial AOD-9604 may vary in purity, counterion content, and residual moisture. Certificates of analysis often report HPLC purity, mass confirmation, and appearance, but testing methods differ between suppliers. Independent verification is sometimes used because labeled content may not match actual peptide amount. Stability under different pH and temperature conditions is not fully standardized across studies. Researchers generally treat lyophilized material as the reference form for weighing and reconstitution. Moisture content can affect accurate mass measurement.

Related pages on this site

Background And Research Context

In the scientific literature, AOD-9604 appears in reviews of growth hormone fragments and in discussions of peptide-based metabolic research. Some sources distinguish it from growth hormone itself, while others group it with compounds marketed for weight management. The evidence base is small compared with approved obesity medications. Questions about long-term efficacy and clinical relevance remain open, and independent replication of key findings is limited. Most published reports are early-stage and exploratory.

AOD-9604 is a synthetic peptide modeled on the C-terminal region of human growth hormone. It is often described as hGH fragment 176-191. Research interest arose because it was designed to isolate possible effects on fat metabolism from other actions of growth hormone. It is not a full growth hormone molecule. Its development history includes early laboratory and animal studies followed by human trials. The peptide has been examined in laboratory, animal, and limited human studies.

Handling, Analysis, and Quality Control

Identity and purity are usually assessed with reversed-phase high-performance liquid chromatography and mass spectrometry. Reversed-phase HPLC separates the peptide from related impurities and can estimate purity by ultraviolet absorbance, while mass spectrometry confirms the molecular mass and detects modifications. Peptide mapping, amino acid analysis, and disulfide mapping may be used when the sequence or disulfide arrangement must be verified. Because AOD9604 contains cysteine residues, oxidation and disulfide isomers are possible quality concerns in synthetic batches.

Quality varies among research-grade suppliers, so certificates of analysis and independent testing are important for verification. A typical certificate reports purity by HPLC, identity by mass spectrometry, appearance, and sometimes residual solvents or water content. AOD9604 is often sold as a research chemical not intended for human consumption, and labels can be inaccurate. Common misconceptions include treating the peptide as a form of growth hormone, assuming supplement status, or expecting approved-drug quality from unregulated products.

Regulatory and Analytical Context

In laboratory settings, AOD-9604 is commonly supplied as a lyophilized powder and stored cold to limit degradation. Reconstituted solutions are typically kept refrigerated or frozen, depending on the buffer and concentration, and protected from repeated freeze-thaw cycles. Stability can be influenced by pH, temperature, and the presence of proteases. Purity is usually assessed by high-performance liquid chromatography and mass spectrometry. These practices support reproducibility, but they do not imply safety or efficacy for any human use.

Regulatory status: AOD-9604 is not approved as a therapeutic drug in the United States, European Union, or other major markets. It is listed by the World Anti-Doping Agency as a prohibited substance in sport, specifically under growth hormone fragments. Many jurisdictions restrict its sale for human consumption. Products marketed online may not meet pharmaceutical quality standards. The legal status varies by country and often depends on whether the material is presented as a research chemical, supplement, or drug.

Further detail

=== Hydrolysis === In aqueous solution, urea slowly equilibrates with ammonium cyanate. This elimination reaction cogenerates isocyanic acid, which can carbamylate proteins, in particular the N-terminal amino group, the side chain amino of lysine, and to a lesser extent the side chains of arginine and cysteine. Each carbamylation event adds 43 daltons to the mass of the protein, which can be observed in protein mass spectrometry. For this reason, pure urea solutions should be freshly prepared and used, as aged solutions may develop a significant concentration of cyanate (20 mM in 8 M urea). Dissolving urea in ultrapure water followed by removing ions (i.e. cyanate) with a mixed-bed ion-exchange resin and storing that solution at 4 °C (39 °F) is a recommended preparation procedure. However, cyanate will build back up to significant levels within a few days. Alternatively, adding 25–50 mM ammonium chloride to a concentrated urea solution decreases formation of cyanate because of the common ion effect.

== Preparation == Home drying of vegetables, fruit and meat can be carried out with electrical dehydrators (household appliances) or by sun-drying or by wind. Preservatives such as potassium metabisulfite, BHA, or BHT may be used, but are not required. However, dried products without these preservatives may require refrigeration or freezing to ensure safe storage for a long time. Industrial food dehydration is often accomplished by freeze-drying. In this case, food is flash frozen and put into a reduced-pressure system which causes the water to sublimate directly from the solid to the gaseous phase. Although freeze-drying is more expensive than traditional dehydration techniques, it also mitigates the change in flavor, texture, and nutritional value. In addition, another widely used industrial method of drying of food is convective hot air drying. Industrial hot air dryers are simple and easy to design, construct and maintain. More so, it is very affordable and has been reported to retain most of the nutritional properties of food if dried using appropriate drying conditions. Hurdle technology is the combination of multiple food preservation methods. Hurdle technology uses low doses of multiple food preservation techniques in order to ensure food is not only safe but is desirable visually and texturally.

Chlorarachniophytes, which belong to the phylum Cercozoa, contain a small nucleomorph, which is a relict of the algae's nucleus. Euglenophytes, which belong to the phylum Euglenozoa, live primarily in fresh water and have chloroplasts with only three membranes. The endosymbiotic green algae may have been acquired through myzocytosis rather than phagocytosis. Another group with green algae endosymbionts is the dinoflagellate genus Lepidodinium, which has replaced its original endosymbiont of red algal origin with one of green algal origin. A nucleomorph is present, and the host genome still have several red algal genes acquired through endosymbiotic gene transfer. Also, the euglenid and chlorarachniophyte genome contain genes of apparent red algal ancestry. Other groups have "red" chloroplasts containing chlorophylls a and c, and phycobilins. The shape can vary; they may be of discoid, plate-like, reticulate, cup-shaped, spiral, or ribbon shaped. They have one or more pyrenoids to preserve protein and starch. The latter chlorophyll type is not known from any prokaryotes or primary chloroplasts, but genetic similarities with red algae suggest a relationship there. In some of these groups, the chloroplast has four membranes, retaining a nucleomorph in cryptomonads, and they likely share a common pigmented ancestor, although other evidence casts doubt on whether the heterokonts, Haptophyta, and cryptomonads are in fact more closely related to each other than to other groups.

In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.

=== Aftermath === An informal memorial was held for Staley on the night of April 20, 2002, at the Seattle Center, which was attended by at least 100 fans and friends, including Alice in Chains bandmates Cantrell, Starr, Inez and Kinney, and Soundgarden frontman Chris Cornell. Staley's body was cremated and a private memorial service was held for him on April 28, 2002 at Kiana Lodge in Poulsbo, Washington. During her appearance on Celebrity Rehab in 2010, Staley's mother said she has kept his ashes in a box. Staley's private memorial was attended by his family and friends, along with his Alice in Chains bandmates, the band's manager Susan Silver and her then-husband Chris Cornell, as well as other music personalities. Chris Cornell, joined by Heart's Ann and Nancy Wilson, sang a rendition of The Rolling Stones' "Wild Horses" at the funeral. They also performed The Lovemongers' song "Sand". Jerry Cantrell dedicated his solo album, Degradation Trip, released two months after Staley's death, to his memory. Cantrell also took in Staley's cat, Sadie, who he and the family took care of until Sadie's death in 2010, at the age of 18. Shortly after Staley's death, his parents Nancy McCallum and Phil Staley started receiving donations from fans all over the world. Nancy and Phil worked with Seattle's Therapeutic Health Services clinic to create the Layne Staley Memorial Fund to help other heroin addicts and their families in the Seattle music community. Alice in Chains remained inactive following Staley's death.

Sources: en.wikipedia.org

Background from the literature

=== Medical use === PABA and its salts are used in nutritional epidemiological studies to assess the completeness of 24-hour urine collection for the determination of urinary sodium, potassium, or nitrogen levels. The potassium salt (potassium paraaminobenzoate, "aminobenzoate potassium") is used as a drug against fibrotic skin disorders, such as Peyronie's disease, under the brand name Potaba. There is a lack of strong evidence. It is believed to work by inhibiting fibroblast glycosaminoglycan secretion and stabilizing monoamine oxidase A activity. PABA is also occasionally used in pill form by sufferers of irritable bowel syndrome to treat its associated gastrointestinal symptoms. PABA derivatives have also been proposed to function as acetylcholinesterase inhibitors in diseases that cause deficient cholinergic systems, such as Alzheimer's disease.

=== 1957 === January 5: The Eisenhower Doctrine commits the United States to defending Iran, Pakistan, and Afghanistan from Communist influence. January 22: Israeli forces withdraw from the Sinai, which they had occupied the previous year. February 15: Andrei Gromyko begins his long tenure as Foreign Minister of the Soviet Union. March 6: The Gold Coast becomes independent from the UK and renamed Ghana, which was under Commonwealth status. May 2: Senator Joseph McCarthy succumbs to illness exacerbated by alcoholism and dies. May 15: The United Kingdom detonates its first hydrogen bomb. August 31: Malaya gains independence from the United Kingdom. October 1: The Strategic Air Command initiates 24/7 nuclear alert (continuous until termination in 1991) in anticipation of a Soviet ICBM surprise attack capability. October 4: Sputnik 1 satellite launched. The same day the Avro Arrow is revealed. November 3: Sputnik 2 was launched, with the first living being on board, Laika. November 7: The final report from a special committee called by President Dwight D. Eisenhower to review the nation's defense readiness indicates that the United States is falling far behind the Soviets in missile capabilities, and urges a vigorous campaign to build fallout shelters to protect American citizens. November 15: Soviet leader Nikita Khrushchev claims that the Soviet Union has missile superiority over the United States and challenges America to a missile "shooting match" to prove his assertion. December 16–19: NATO holds its first summit in Paris, France.

In 2010, Mayor Bing proposed a plan to bulldoze one-fourth of the city. Detroit is a metropolis that sprawls 139 square miles. In comparison, Manhattan is just over 22 square miles. The sprawling nature of the city is conducive to urban decay. The mayor planned to concentrate Detroit's remaining population into specific areas to improve the delivery of essential city services, which the city has had significant difficulty providing (policing, fire protection, trash removal, snow removal, lighting, etc.). In February 2013, the Detroit Free Press reported the Mayor's plan to accelerate the program. The project has hopes "for federal funding to replicate it [the bulldozing plan] across the city to tackle Detroit's problems with tens of thousands of abandoned and blighted homes and buildings." Bing said the project aims "to right-size the city's resources to reflect its smaller population." Despite this, there is still an estimated 20 square miles of empty land within the city limits. The average price of homes sold in Detroit in 2012 was $7,500. As of January 2013, 47 houses in Detroit were listed for $500 or less, with five properties listed for $1. Despite the extremely low price of Detroit properties, most of the properties have been on the market for more than a year as the boarded-up, abandoned houses of the city are seldom attractive to buyers. The Detroit News reported that more than half of Detroit property owners did not pay taxes in 2012, at a loss to the city of $131 million (equal to 12% of the city's general fund budget).

=== Acute calculous cholecystitis === Gallstones blocking the flow of bile account for 90% of cases of cholecystitis (acute calculous cholecystitis). Blockage of bile flow leads to thickening and buildup of bile causing an enlarged, red, and tense gallbladder. The gallbladder is initially sterile but often becomes infected by bacteria, predominantly E. coli, Klebsiella, Streptococcus, and Clostridium species. Inflammation can spread to the outer covering of the gallbladder and surrounding structures such as the diaphragm, causing referred right shoulder pain.

Sources: en.wikipedia.org

Frequently asked questions

What is AOD-9604?

It is a synthetic peptide based on a C-terminal fragment of human growth hormone. It is commonly referred to as hGH fragment 176-191 and is studied for metabolic effects rather than growth effects.

Is AOD-9604 the same as human growth hormone?

No. It represents only a short portion of the hGH sequence and lacks the full hormone's structure. As a result, its biological activity and regulatory status differ from those of prescription hGH.

Does AOD-9604 occur naturally?

The exact peptide is not typically described as a circulating hormone; it is a synthetic construct based on a natural sequence. Fragments of hGH can exist in laboratory or metabolic contexts, but AOD-9604 itself is manufactured for research.

What is AOD-9604?

AOD-9604 is a synthetic peptide fragment of human growth hormone. It corresponds to the C-terminal region known as hGH 176-191 and is studied for metabolic effects. It is not an approved therapeutic drug.

Network